Bananas (Musa spp.) is an important crop which has high economic and nutritional values, but it is also very susceptible to diseases, especially anthracnose caused by Colletotrichum spp. In particular, Colletotrichum musae is the most common pathogen causing banana anthracnose and leading to yield loss. Therefore, developing a method for identification of C. musae has received a lot of attention from scientists, recently. In this study, Colletotrichum spp. were isolated from anthracnose lesions of different banana cultivars collected in Viet Nam including Can Tho, Da Lat, Hau Giang, Soc Trang and Vinh Long. Pathogenicity of fungal strains was tested using 3 common banana cultivars in Vietnam (Gia, Xiem and Cau). Specific primers for C. musae were designed on the glyceraldehyde-3- phosphate dehydrogenase (GADPH) gene sequence to accurately identify C. musae causing anthracnose on bananas. In this study, 11 strains of Colletotrichum spp. were isolated from anthracnose lesions. Of which, the G2 strain showed the highest pathogenicity (lesion diameter: 19.33 mm) while the CA strain had the lowest pathogenicity (lesion diameter: 7.44 mm). The two primers CM1 (5' CCGCTGTAATCTACATCTC 3') and CM2 (5' CTGATATGAGTGATAGCATGTA 3') were designed to generate the 115-bp DNA amplicon, a specific product for Colletotrichum musae. PCR results showed that 6/11 isolated fungal strains were identified as C. musae. These strains have the highest pathogenicity in the pathogenicity test, especially the G2 strain.