Đăng nhập
 
Tìm kiếm nâng cao
 
Tựa bài viết
Tác giả
Năm xuất bản
Tóm tắt
Lĩnh vực
Phân loại
Số tạp chí
 

Bản tin định kỳ
Báo cáo thường niên
Tạp chí khoa học ĐHCT
Tạp chí tiếng anh ĐHCT
Tạp chí trong nước
Tạp chí quốc tế
Kỷ yếu HN trong nước
Kỷ yếu HN quốc tế
Book chapter
Kỷ yếu hội nghị quốc tế 2014
Số tạp chí 98(2014) Trang: 427
Tạp chí: Plant disease

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as “black spot disease” in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5′GTTTCCGTAGGTGAACCTGC 3′) and AB28 (5′ATATGCTTAAGTTCAGCGGGT 3′) were used to amplify extracted DNA from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml–1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species.

Các bài báo khác
Số tạp chí (2014) Trang: 3077-3078
Tác giả: Lâm Nhựt Khang
Tạp chí: AAAI, Québec City, Québec, Canada, July 27–31, 2014
Số tạp chí (2014) Trang: 106-111
Tạp chí: ACL, Baltimore, Maryland, USA, June 22-27, 2014
Số tạp chí (2014) Trang: 54-62
Tạp chí: ACL- ComputEL, Baltimore, Maryland, USA, June 22-27, 2014
Số tạp chí (2014) Trang: 1219-1234
Tạp chí: International Conference on Kansei Engineering and Emotion Research
Số tạp chí Proceedings(2014) Trang: 155-161
Tạp chí: The Fifth Symposium on Information and Communication Technology
Số tạp chí (2014) Trang: 294-299
Tạp chí: 9th International Symposium on Lowland Technology
Số tạp chí (2014) Trang: 333-337
Tạp chí: 9th International Symposium on Lowland Technology
Số tạp chí (2014) Trang: 37-41
Tạp chí: International Symposium on Lowland Technology 2014
Số tạp chí (2014) Trang: 71-78
Tạp chí: 9th International Symposium on Lowland Technology
Số tạp chí 1(2014) Trang:
Tạp chí: IEEE PES Innovative Smart Grid Technologies Europe
Số tạp chí (2014) Trang: 555-560
Tạp chí: The 23rd IEEE International Symposium on Robot and Human Interactive Communication, Edinburgh, UK, 25-29 Aug. 2014
Số tạp chí (2014) Trang: 516-521
Tạp chí: The 2014 IEEE International Conference on Robotics and Biomimetics, Bali, Indonesia, 5-10 December 2014
Số tạp chí (2014) Trang: 624-625
Tạp chí: The National Congress of Agriculture, Rural Engineering Society 2014
Số tạp chí (2014) Trang: 142-147
Tạp chí: SEICO 14-35th International Technical Conference & Forum, Paris-France, March 10th-11th 2014
Số tạp chí (2014) Trang: 97-100
Tạp chí: Innovations in Energy, Power and Electrical Machines (IEPEM-2014), Istanbul - Turkey, August 22-23, 2014
Số tạp chí (2014) Trang: 726
Tạp chí: 4th International Rice Congress, 27 October - 1 November 2014, Bangkok, Thailand
Số tạp chí (2014) Trang: 795
Tạp chí: 4th International Rice Congress, 27 October - 1 November 2014, Bangkok, Thailand
Số tạp chí (2014) Trang: 530
Tạp chí: 4th International Rice Congress, 27 October - 1 November 2014, Bangkok, Thailand
Số tạp chí (2014) Trang: 181-198
Tạp chí: 4th International Fisheries Symposium, 30th-31st October 20141, surabaya, Indonesia, Malaysia
Số tạp chí (2014) Trang: 101
Tạp chí: the 10th Annual CamTESOL Conference Feb 2014 in Cambodia
Số tạp chí Monograph no. 3(2014) Trang:
Tạp chí: Developing Educational Professionals in Southeast Asia DEPISA Monograph no. 3
Số tạp chí (2014) Trang: 65-65 (poster)
Tạp chí: The 3rd Asia Pacific Symposium on Postharvest Research, education and Extension (8-11 December 2014, Hp Chi Minh city, Vietnam)
Số tạp chí (2014) Trang: 2406 - 2412
Tạp chí: IPEC 2014 (ECCE-Asia), Hiroshima, Japan, May 18-21, 2014
Số tạp chí (2014) Trang: 71-72
Tạp chí: KIPE Summer 2014, Korea, July 2014


Vietnamese | English






 
 
Vui lòng chờ...